Journal of Virology

Journal of Virology

4.11 - 1251 ratings - Source



... 868 CCAGGTGTGATTACAGTAACAATCGACCAGATCTAATAACGTGTCCGC SexAI, Sacll 3E-5EA250 agt;alt; 84-I10 869 ... Spcl, Mlul, Sacl I 3E-5EA?50 X 84-I20a#39; 1081 GGACACGTTATTAGATCTGGTCGCGATGGCAATTAATCACA I082 TCGAGCI I ... Transcription was performed with the AmpliScribe T7 kit (Epicenter) according to the manufacturera#39;s instructions. ... Sequence comparison of the 3a#39; and 5a#39; end of the EBOV genome revealed stretches of complementary nucleotides withinanbsp;...


Title:Journal of Virology
Author:
Publisher: - 2005
ISBN-13:

You must register with us as either a Registered User before you can Download this Book. You'll be greeted by a simple sign-up page.

Once you have finished the sign-up process, you will be redirected to your download Book page.

How it works:
  • 1. Register a free 1 month Trial Account.
  • 2. Download as many books as you like (Personal use)
  • 3. Cancel the membership at any time if not satisfied.


Click button below to register and download Ebook
Privacy Policy | Contact | DMCA